E-ISSN 2218-6050 | ISSN 2226-4485
 

Research Article


Open Veterinary Journal, (2023), Vol. 13(7): 807–818

Original Research

10.5455/OVJ.2023.v13.i7.1

Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping

Esraa O. Abdelrasoul, Ashraf A. Moawad and Ayah B. Abdel-Salam*

Department of Food Hygiene and Control, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt

*Corresponding Author: Ayah Badawi Abd-El-Salam. Department of Food Hygiene and Control, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt. Email: ayah.badawi [at] vet.cu.edu.eg

Submitted: 30/04/2023 Accepted: 03/06/2023 Published: 31/07/2023


Abstract

Background: Dairy confectionaries are recently categorized as an important part of different consumers’ diets with increasing demand for cream-based cakes “Tourta” and gateau which are used as celebrating food for almost all occasions and celebrations.

Aim: The study was designed for evaluating general quality and safety of such products.

Methods: 100 cream-based (for topping and filing) samples; 50 cakes “Tourta” and 50 gateau, were purchased separately from several pastry shops covering international, national, and local brands in Great Cairo, Egypt, and subjected to microbiological analysis.

Results: Results showed that international brands were the best for gateau samples while national brands were the best quality for cake samples. Regardless of the brand, the general hygienic quality of the cake product “Tourta” was lower on an average total colony, coliforms, yeast, and mold counts as compared with the gateau product. Although coliforms were found in 100% of the examined samples with the highest mean value of 33 × 102 ± 7.0 × 102 CFU/g in local gateau samples, Escherichia coli and Salmonella spp. could not be detected in these samples. Staphylococcus aureus was isolated from 8% of the total examined samples with the highest incidence of (22.2%) and a mean count of 38 × 10 ± 6.0 × 10 CFU/g in local brand gateau samples. Bacillus cereus was extensively isolated with the highest incidence in cake samples (32%) and mean counts higher than 103 in all of the examined samples. Bacillus cereus strains have harbored more than one toxigenic gene. In this aspect, nhe gene was the most predominant one as it was detected in 100% of the examined isolates, followed by cytK gene in 80%, whilehbl and ces genes could not be found. According to the Egyptian Standard specifications for cake (ES: 4037/2020), a higher acceptability degree was reported for the international brand gateau and cake “Tourta” samples. The incidence of using any preservative as an inhibitory substance was also analyzed generally using the Bacillus subtilis disk assay technique, but all samples were negative using this technique indicating the need for a more advanced technique for its detection such as using high-performance liquid chromatography.

Conclusion: Finally, it was concluded that; more attention is needed to cream-based cakes’ quality and safety, with essential modification required in the standards of cakes in Egypt.

Keywords: Bacillus cereus, Cream-based cakes, Dairy confectionaries, Gateau, B. cereus toxigenic genes.


Introduction

Dairy confectionery products can be grouped into five categories: dried milk-based products, fermented products, acid-coagulated products, cereal-based desserts, and fat-rich products (Peter, 2008). Between these products; cakes are the most popular with different toppings and fillings especially those with cream. Filling cream is an important component of cakes, it is fat and sugar based to provide the desired texture, taste, and union of the baked cake besides its role as a dietary source of main nutrients; protein, carbohydrates and fat (Nicoletta et al., 2015). The consistent safety and quality of the finished product are dependable on the quality of milk and the processing conditions which should be standardized (Peter, 2008).

It may touch on mind that there is a low incidence of microbial hazards in these products due to their exposure to elevated temperatures during the baking process, baking temperatures only kill vegetative forms of pathogens, while baked food is made of grains and powders, which are commonly contaminated with spore-forming organisms than vegetative form. During dough proofing, microbial growth of these spores occurs (Abd El-Rady et al., 2016). Also, cakes are usually filled, layered, or covered with whipped and buttercream that is not conducted to heat treatment and they may contain pathogens and be excellent material for microbial growth and toxins production due to their high water activity, nearly neutral pH, and high nutrients (Sherif et al., 2018).

Cream-based cakes may be contaminated with pathogens from different sources as; improper handling during slicing, adding ingredients, and decoration especially with bad personal hygiene, followed by temperature abuse during storage. Application of one of the food safety management systems as hazard analysis critical control points (HACCP) for example can manage these risks (FSAI, 2018).

Food poisoning of cream-based cakes had been sporadically reported and had been linked to several pathogens including Staphylococcus aureus, Bacillus cereus, Salmonella species, or Escherichia coli (EFSA and ECDC, 2014; Wiwanitkit, 2015; CDC, 2016), which may negatively affect the economic, public health and nonconformity with food safety standards and legal specifications (Choi et al., 2016).

Staphylococcus aureus is one of the toxin-producing pathogen which hase concern, especially for chilled foods, however its importance is declared only when the produced food is stored in cooled conditions slowly or re-contaminated during storage (Brown, 2008). Wiwanitkit (2015) reported a case study of Staphylococcus toxin food poisoning due to the consumption of coconut cream-filled green tea cake, it was characterized by rapid acute abdominal pain after 4 hours of eating which furtherly progressed to severe diarrhea and vomiting.

After S. aureus the second emerged foodborne pathogen is B. cereus and it was identified as the causative agent responsible for about 19% of foodborne outbreaks which were reported in the United States from 1998 to 2008 (Bennet et al., 2013). The foods most frequently linked to outbreaks are those that have been cooked or contain cooked ingredients, especially those high in protein or starch such as pudding, spores can survive cooking, and if cooling is insufficient; they can germinate and grow into vegetative cells (Bennett et al ., 2015b). Bacillus cereus produces about six types of toxins; including cereulide (an emetic toxin), a cytotoxin (cytK), and four enterotoxins (hemolysin BL, non-hemolytic enterotoxin, FM, and enterotoxins T). According to FDA (2012); cereulide toxin could be destroyed at 121°C for 30 minutes, resist proteolysis, has pH from 2 to 11 and is cold stable (4°C for 60 days), while hbl toxin suggested being the main virulence factor in diarrhea caused be B. cereus but it is sensitive to heat; as it could inactivate at 56°C for 5 minutes. (Logan and De Vos, 2009).

The prevalence of Salmonella spp. in different bakery products has been interesting for many years. According to a case report delivered by Fielding et al. (2003) in September 2003, a Salmonella typhimurium outbreak related to cheesecake eating was recorded; the environmental inspection identified the cracked fecal contaminated eggs and mishandling from workers as the potential sources of Salmonella in this case. But nowadays, the use of pasteurized egg in cake industry had greatly reduced the incidence of Salmonella from such products. The Centre for Disease Control (CDC) estimates outbreaks due to Salmonella of about 1.35 million cases of infections, about 26,500 of them need hospitalizations, and 420 cases end with death in the United States each year related to food (CDC, 2022).

Escherichia coli is another one of the most important pathogens that cause food poisoning, it has been used as a fecal contamination indicator in fresh foods and its presence in high concentrations may occasionally connect with a higher likelihood of enteric pathogens presence (Kornacki et al., 2015). A multistate E. coli outbreak connected to cake mix was reported by the CDC in July 2021; 16 persons became sick across 12 states linked to cake mix. Escherichia coli infections become more serious for children with the development of severe illness (CDC, 2021).

Microbial spoilage of cakes may occur by molds and yeasts as the main cause and by bacteria only occasionally, this is owing to reduced water activity (0.94) and pH (5.4–7.5) (Sherif et al., 2018). Foods are rarely connected with infectious fungi, but some yeast can cause allergies, and some molds can infect people with compromised immune systems in addition to mycotoxins production (Da Silva et al., 2018).

Re-formulation of cake recipes by manipulating water activity and/or pH of fillings is sometimes useful for extending their shelf life (Rodriguez-Garcia et al., 2012). Certain synthetic chemicals could be used as food preservatives such as sorbic, acetic, ascorbic, and propionic acids, in addition to their salts in order to improve cake product's safety and quality (Saranraj and Geetha, 2012). Long-term consumption of these chemicals leads to several side reactions which can be either immediate or build up in the body over time (Sanjay, 2015).

Serving safe foods to consumers is mandatory to ensure public health (Shohana et al., 2019). The aim of this research was to investigate the microbiological state of some dairy confectionaries (cream-based cakes “Tourta” and gateau) from different brands in Egyptian markets regarding the incidence of using inhibitory substances for preserving purposes. Several bacteria were isolated and identified based on the biochemical examination and B. cereus virulence genes were investigated using PCR technique which has limited data in Egypt.


Materials and Methods

Samples collection

Our study was directed in the period between November 2021 and July 2022, a total number of 100 commercially prepared cream-based confectioneries (50 cakes “Tourta” and 50 Gateau) were randomly obtained from different suppliers representing; (A) international brands chains, (B) national brands chains, and (C) local shops in different districts of great Cairo governments. Samples selection and collection was done based on an online survey by 1,300 participant from cake consumers in Egypt to select the most common cake brands, shops, types, and categories (Esraa et al., 2022). Samples were transferred immediately to the laboratory in an insulated ice box without delay. Collected samples were firstly subjected to complete chemical analysis, fatty acid profile, and nutritive value assessment, in addition to their compatibility to the Egyptian standards (Esraa et al., 2023), and then the same samples were subjected to microbiological analysis.

Microbiological analysis

Preparation of samples and decimal dilution

From each sample, eleven grams were separately added to 99 ml of 0.1% sterile peptone water in a polyethylene bag and homogenized using a blender (Grindomix GM200, Retsch, Haan, Germany) for 30 seconds at room temperature, then 10-fold decimal dilutions were prepared in sterile 0.1% peptone in water (Taylor et al., 2015).

Enumeration of microorganisms in examined samples

For determining the microbiological quality, samples were analyzed for total colony count according to (ISO, 4833-1: 2013) on Standard plate count agar medium and total yeast and mold count (ISO, 21527-1: 2008) on Sabaroud agar medium, Coliforms count using three tubes method (MPN/g) using Lauryl Sulphate broth, total Staphylococci count, S. aureus on Baired Parker agar and B. cereus counts on MYP medium using spreading technique were done according to APHA (2015).

Isolation and identification of specific pathogens from the examined samples

All samples were examined for the incidence of B. cereus, S. aureus, and E. coli (APHA, 2015) and Salmonella species (ISO, 6579-1: 2017) as main pathogens expected to be present in cream-based cakes “Tourta” and gateau samples.

  • Biochemical confirmations of the B. cereus group including: anaerobic glucose fermentation, Voges-Proskauer, tyrosine decomposition, nitrate reduction, Rhizoid growth, lysozyme resistance, motility tests, and hemolytic activity were done on suspected isolates (Bennett et al., 2015b).
  • For S. aureus; coagulase, catalase, thermostable nuclease (thermonuclease), lysostaphin sensitivity, anaerobic utilization of glucose, and mannitol fermentation tests were done to confirm the examined isolates identification (Bennett et al., 2015a).
  • Salmonella species suspected isolates were confirmed biochemically using oxidase (Kovac’s), H2S (Triple Sugar Iron), lysine decarboxylase, Methyl red, Voges-Proskauuer, Motility, Nitrate reduction, Citrate utilization, and Indole production tests (Brenner and Farmer, 2005).
  • For E. coli isolates confirmation, IMViC tests (indole, methyl red, Voges-Proskauer, and citrate) were done for all isolates (Da Silva et al., 2018).

Molecular identification of biochemically confirmed B. cereus isolates and detection of its virulence genes (Deoxyribonucleic acid extraction and multiplex PCR for virulence genes detection)

Deoxyribonucleic acid from the previously identified B. cereus cultures was extracted using a QIAamp DNA Mini kit (Catalogue no., 51304). GroEL gene detection was performed by Emerald AmpGT PCR master mix (Code No. RR310A) using Oligonucleotide primers sequences (Metabion, Germany) at 533 bp, (TGCAACTGTATTAGCACAAGCT: TACCACGAAGTTTGTTCACTACT), and recognized using B. cereus positive control as B. cereus (ATCC® 10876TM).

  • Molecularly identified B. cereus cultures were analyzed for enterotoxigenic genes (hbl, cytK, nhe, and ces). The sequences (F: R) of primers were (GTA AAT TAI GAT GAI CAA TTTC: AGA ATA GGC ATT CAT AGA TT; AAG CIG CTC TTC GIA TTC: ITI GTT GAA ATA AGC TGT GG; ACA GAT ATC GGI CAA AAT GC: CAA GTI ACT TGA CCI GTT GC and GGTGACACATTATCATATAAGGTG: GTAAGCGAACCTGTCTGTAACAACA) for hbl, nhe, cytK, and ces genes at 1,091, 766, 421, 1,271 bp, respectively. PT-100 Thermo-cycler (MJ Research, USA) was used to achieve the amplification cycles. Polymerase chain reaction was done twice per isolate and to visualize the products; 1.5% (Tris Borate EDTA) agarose gels were used and examined via UV. The molecular identification materials used, steps, and primer sequences were applied according to Sambrook et al. (1989), Ehling-Schulz et al. (2006), and Das et al. (2013).

Detection of inhibitory substances in some of the examined cake samples

Sample preparation

Ten grams from 30 cake samples (with the lowest total colony counts) were presoaked overnight in 100 ml of sterile distilled water (SDW). The extract was filtered using thick filter papers (35 mm diameter) and centrifuged at 5,000 rpm for 25 minutes. After that, the supernatant was filtered by using a 0.2 μm bacteriological filter (Shandeep et al., 2021).

Antimicrobial assay method for detection of inhibitory substances

Bacillus subtilis ATCC 6633 was grown in liquid brain-heart infusion media at 37°C for 6 hours. Mueller-Hinton agar (Oxoid) plates previously prepared and solidified were swapped with 0.1 ml inoculum of B. subtilis broth (106 cells/ml−1). Each cake sample prepared filtrate was inoculated with a suitable amount in a circular well (10 mm diameter) in the agar plate containing B. subtilis after dryness. After that, the plates were incubated at 37°C ± 2°C for 24 hours, and the diameter of the zone of inhibition of the bacterial growth was measured in mm using a zone inhibition scale. The presence of an inhibition zone indicates the incompatibility of inhibitory substances and vice versa. A control negative well was inoculated with SDW and chloramphenicol 0.1% was inoculated in another well as a control positive. Each test was carried out three times for more confirmation of results (Mahantesh et al., 2019).

Statistical analysis

One-way analysis of variance using Excel of Microsoft 365 enterprise was done to analyze the results of different parameters.

Ethical approval

Not needed for this study. All authors are committed to general research ethics and the journal ethics and rules.


Results

Results in Table 1 explored that the highest mean counts for total colony count, total mold, and yeast were 13 × 106, 10 × 105, and 46 × 105 CFU/g, respectively in national brand gateau samples, while the highest mean counts for total Staphylococci, Coliforms, S. aureus, and B. cereus were 23 × 104, 33 × 102, 38 × 10, and 55 × 102 CFU or MPN/g, respectively in local brand gateau samples. It was also clear that the highest prevalence of S. aureus was (22.2%) and B. cereus was (66.7%) in local brand gateau samples and it couldn’t be isolated from international brand gateau samples and both organisms were isolated from one sample only (5%) of the national brand samples. On the other side, Salmonella spp. and E. coli couldn’t be detected in all examined samples.

By examining the microbiological quality of cream based cake samples (Tourta) as shown in Table 2, the highest mean count for the total colony and total mold was 76 × 105 and 97 × 103 CFU/g, respectively in the international brand group, while the highest mean counts for total Staphylococci, coliforms, and yeast were 40 × 104, 25 × 102, and 49 × 104 CFU or MPN/g, respectively in local brand samples. The highest prevalence of S. aureus was (15%) and B. cereus was (55%) in local brand Tourta samples, while S. aureus couldn’t be isolated from any of the international and local brand samples. The same as in gateau samples; Salmonella spp. and E. coli couldn’t be detected in all examined cream-based cake samples.

After biochemical identification of B. cereus strains isolated from all examined samples, some isolates (five isolates) were subjected to molecular identification for more confirmation (Fig. 1). The incidence of toxigenic genes in these confirmed isolates have been examined and it was found that B. cereus harbored more than one toxigenic gene. The nhe gene was detected in all of the examined isolates (100%), followed by cytK gene (80%), while hbl and ces genes could not be found (Table 3 and Fig. 2). Also Figure 3 showed that there is a great relationship between hemolytic activities of B. cereus isolates obtained from examined samples and the obtained toxigenic genes.

According to the Egyptian Standard specifications for cake (ES: 4037/2020) the higher acceptability degree was reported for the international brand gateau (100% for all parameters) and cake “Tourta” samples (100% for all parameters, except for mold 75% and B. cereus 83.33%).

Unfortunately, inhibitory substances could not be detected in any of the examined samples using the B. subtilis disc assay technique. That does not indicate the real absence of inhibitory substances from cream-based cakes, but it may indicate the low sensitivity and specificity of this technique.


Discussion

Cakes, especially the cream-based one “Tourta” with different ingredients of topping and filling, could be considered nowadays as the most popular confectionaries in our country. The cream-based cake is one of the milk-based confectioneries with high production and consumption rates. During the production of such products, several ingredients are used; as: milk, eggs, wheat flour, cream, fresh fruits, jelly, chocolate, and coloring and flavoring agents (Hassan et al., 2018). The finished product properties, quality, and stability during shelf-life are dependable on these ingredients’ quality (Hanee, 2013).

Thermal processing such as baking is the most widely used method to control pathogens in ready-to-eat cakes; however, the effectiveness of the thermal process depends primarily on the heat resistance of microorganisms and other factors including water activity (aw; above 0.94), pH (5.4–7.5), and fat content (30%–60%)of the final product (Vincenzo et al., 2020). Contaminated processed food like cakes is a serious situation threatening public health. Thus, the continuous evaluation of final products before their declaration as compared with different food standard guidelines is mandatory (Shohana et al., 2019), he added that the maximum permissible limits in ready-to-eat foods (as cakes) for total plate count is <105 CFU/g, yeast, and mold is <104 CFU/g, coliform bacteria <200 MPN/g with the absence of E. coli.

Cream-based cakes are sold in Egyptian markets in several forms; commonly the one-piece large size form (Tourta) and small pieces form (Gateau) with the same filling, topping, and decorations are extensively sold in different pastry shops of different brands (international, national, and local). The extensive use of these products by consumers from different categories on different occasions, together with the considerable lack of reported data on their microbiological quality and safety encouraged studying such products.

The most widely used general indication of bacterial populations in food is the total aerobic plate count. It indicates the product's hygienic quality, manufacturing procedures, raw materials, processing conditions, handling procedures, and shelf life, but it is a poor indicator of food safety (Da Silva et al., 2018). The examined gateau samples from the national brand were of the lowest quality among brands as shown in Table 1; with a total colony, mold, and yeast counts mean values of 13 × 106 ± 3.0 × 106; 10 × 105, and 46 × 105 ± 13 × 105 CFU/g, respectively. These high counts could be linked to the high production with low release rates than other brands, together with the fact that in these brands, one factory manufactures and then distributes the cakes to several branches of the same brand which increase the contamination probability during transportation due to temperature abuse.

On the other side, low personal hygiene was very obvious in gateau samples from local brands; where there is more intensive contact between the staff and the product with little or no awareness about the hygiene concept or management system. Data in Table 1 showed that the highest mean count of total Staphylococci was 23 × 104 ± 11 × 104 CFU/g and incidence of S. aureus in 22.2% of the samples with a mean count of 38 × 10 ± 6.0 × 10 CFU/g in this group.

Table 1. Microbiological analysis of the examined cream-based “Gateau” samples from different brands (total number=50).

Table 2. Microbiological analysis of the examined cream-based cake “Tourta” samples from different brands (total number=50).

In the field of confectionaries, especially cream-based cakes, regarding food safety and quality, the ICMSF (2003) recommended several steps for improving the final product quality including: using pasteurized eggs and dairy products, the separation between cooked and raw materials, limiting the aerosols, and dust in food preparation and displaying area, efficient cleaning, product holding at 5°C or below and using well-trained food handlers.

Fig. 1. Amplicons of B. cereus isolates on agarose gel using groEL (533 bp). Lane (1–5) B. cereus isolates, and Lane (L) DNA ladder 100 bp molecular weight marker.

Although Jay (2000) noted that cakes of all types rarely undergo bacterial spoilage due to their unusually high concentrations of sugars, which restrict the availability of water, this state was not the same in the case of cream-based cake samples as shown in Table 2. Results for cream-based cake samples “Tourta” from the international brand were shocking; as it showed the highest mean values for the total colony, mold, and yeast counts 76 × 105 ± 33 × 105; 97 × 103± 14 × 103 and 47 × 104 ± 7.0 × 104 CFU/g, respectively. While on the other side, samples from national brands showed better quality between brands with the lowest values for different examined organisms (Table 2).

These results are in match with those obtained from a survey of cakes by Sherif et al. (2018), where 50% of examined samples had aerobic microbial counts of 1–5 × 106 CFU/g, 16% were more than 106 CFU/g, 6.5% were more than 107 CFU/g.

Our obtained results were higher than those obtained by Visan and Bara (2010) who examined chocolate cake quality and found that TCC were varied between 6.8 × 103 and 1.4 × 104CFU/g. Also El-Fadaly et al. (2016) studied 30 cake samples with microbial quality and found that the contamination rate with mesophilic bacteria ranged between 1.2 × 102 and 28.6 × 104 CFU/g.

In comparison with our results, Sharifzadeh et al. (2016) examined 228 cream-based pastries and the microbial tests showed that 33.33% of all samples were contaminated by microbial agents with a high contamination rate with coliforms (61.84%), Staphylococci (48.68%), and yeast (27.63%).

Data presented in Tables 1 and 2 showed that regardless the brand; the general hygienic quality of cake “Tourta” product is better than gateau, where the cake showed lower average total colony, coliforms, yeast, and mold counts of 37 × 105 ± 18 × 105, 12 × 102 ± 0.4 × 102, 34 × 103 ± 9.0 × 103, and 38 × 104 ± 8.0 × 104 CFU or MPN/g, respectively. This fact may be attributed to several factors such as; its high price which provides the use of high-quality raw materials, low production rate (produced by piece), specific displaying refrigerator, and the dependence on specific handlers even during processing.

Table 3. Molecular identification and incidence of toxigenic genes in 5 B. cereus isolates isolated from the examined samples.

Fig. 2. Agarose gel electrophoresis of PCR products of B. cereus genes found in examined samples by direct multiplex PCR. nhe (766 bp) and cytK (460 bp), Lane (1–5) B. cereus isolates, and Lane (L) DNA ladder 100 bp molecular weight marker.

Fig. 3. Relationship between hemolytic activities of B. cereus isolates obtained from examined samples and the obtained toxigenic genes (No.=5; the isolates harboring gro EL gene). * All examined isolates showed strong hemolytic activity. * hbl and ces genes were absent in all the examined isolates.

Food poisoning from eating contaminated cakes has been sporadically reported (Wiwanitkit, 2015). The accidental contamination of food from unhygienic food handler is the main cause of Staphylococcal food intoxication, especially after the baking process, as the baking process has the ability to get rid such organism completely. Staphylococci overgrowth commonly occurs due to poor refrigeration preservation before eating (Pereira et al., 1994; Anunciaçao et al., 1995). Staphylococcal food poisoning can be caused by as little as 20–100 ng of enterotoxin (Asao et al., 2003).

Staphylococcus aureus was isolated from 8% of all examined samples with the highest incidence (22.2%) and a mean count of (38 × 10 ± 6.0 × 10 CFU/g) in local brand gateau samples. These samples could increase the probability of S. aureus food poisoning as it exceeds the guideline limit (20 – <100 CFU/g) reported by FSAI (2011). The rapid cooling of produced cake in refrigerator temperature <6°C is the main factor controlling the growth of S. aureus and the incidence of toxin production, as 7°C is the minimum temperature allowing growth of coagulase-positive Staphylococci, while the minimum temperature for staphylococcal enterotoxins production is 10°C (FSAI, 2011).

These results were in agreement with El-Fadaly et al. (2016) who isolated S. aureus from 9 samples only out of 30 samples with a count ranging between 3.7 × 10 and >1 × 103 CFU/g, while higher figures were found by Sherif et al. (2018) in cake samples collected from Damietta and Dakahlia governorates as the S. aureus was presented in nearly 77% of the tested samples with the highest value of 35 × 102 CFU/g.

WHO (2007) stated that B. cereus is highly spreadable in pasteurized dairy products including cream. Foodborne diseases resulting from B. cereus are two types: diarrheal and emetic syndromes. The diarrheal type occurs when consuming food contaminated with 104 to 109 cells of B. cereus per gram of food, followed by enterotoxin production in the small intestine, compared with consuming food with toxin in the emetic form, which occurs when B. cereus reaches a population of 105–108 cells per gram of food (Logan and De Vos, 2009).

Bacillus cereus was extensively isolated from the examined samples from different brands with a higher incidence in “Tourta” samples (32%) than in gateau samples (26%). The mean count in all types of samples was higher than 103, and the highest mean values were reported for local brand gateau samples (55 × 102 ± 18 × 102 CFU/g) and national brand Tourta samples (44 × 103 ± 12 × 103 CFU/g) as shown in Tables 1 and 2. This count according to Logan and De Vos (2009) is risky with a high incidence of toxin production and food poisoning, so further molecular identification and incidence of toxigenic genes in the isolated strains were done for risk assessment. Similar figures were reported by El-Fadaly et al. (2016) and Sherif et al. (2018).

High microbial contamination level in examined samples indicates low-quality raw materials and poor production hygienic levels during cream-based cake processing. Bacillus cereus is a spore-forming microorganism which makes it easily spreadable in heat-treated, sterilized, pasteurized and processed dairy-based ready to eat food products with high risk (Kotiranta et al., 2000). The impact of B. cereus presence in food is not only on public health but also on the economic aspects through the final product shelf life reduction and spoilage via spoilage enzymes as: lipase, lecithinase, and protease, with subsequent losses (Wallaa, 2018).

By testing five of biochemically identified and confirmed B. cereus isolates that showed complete hemolytic activity using the PCR technique; the groEL gene was found in all of the examined isolates (100%) that confirm the incidence of B. cereus identified biochemically from different samples (Fig. 1). Bacillus cereus isolates have harbored more than one toxigenic gene; nhe gene was the most detected gene (100%), followed by cytK gene (80%), while hbl and ces genes could not be found in any of examined isolates (Figs. 2 and 3). Our results about B. cereus toxigenic genes incidence were similar to those recorded by Zhao et al. (2020) and Adam et al. (2021). Bacillus cereus with different counts and high toxigenic power is considered a hazard to consumer and increase the risk of cream-based cake products sold in Egyptian markets from national and local brands.

Although coliforms were detected in all examined samples (100%), it was found in low counts with the highest mean values of 33 × 102 ± 7.0 × 102 and 25 × 102 ± 6.0 × 102 MPN/g in local gateau and cake “Tourta” samples, respectively. The presence of Coliforms in different dairy desserts may be due to insufficient heat treatment, contaminated water, and contamination during serving, or poor sanitary practices of handlers (Shohana et al., 2019). Lower results were reported by Sherif et al. (2018) as only 63% of the total examined cake samples were positive for Coliforms.

Salmonella sp. and E. coli could not be detected in all of the examined samples from different brands. Several cake studies couldn’t also isolate E. coli from their samples (El-Fadaly et al., 2016; Sherif et al., 2018; Shohana et al., 2019).

By comparing the obtained results with the Egyptian Standard specifications for cake (ES: 4037/2020), the highest acceptability degree was reported for the international brand gateau and “Tourta” samples (Fig. 4). The local brand gateau samples were the most unacceptable brand for several unsatisfactory parameters including mold presence and high incidence of S. aureus and B. cereus; on the other hand, for the cake samples, the national group samples showed the lowest acceptability level especially due to the presence of B. cereus organism with a high incidence of about 55% of the examined samples, which were unacceptable as matched with the Egyptian Standards. Higher unacceptable levels due to microbial contamination of cream-based cakes from Egyptian markets were reported by El-Fadaly et al. (2016) and Sherif et al. (2018), while lower levels of unacceptability were recorded by Hassan et al. (2018), in Iran.

In a study done by Abd El-Rady et al. (2016), dried milk powder was defined as the most potential hazard raw material for safe filling cream production. When HACCP system was applied to different production processes; whipping step was identified as the critical control point in this process. The study suggested variable control measures such heat treatment, natural preservatives application, with reduction of pH to guarantee safety of such product or even other food products containing filling cream as cakes.

Preventing the growth of microorganisms in the world of dairy confectionaries could be easily applied by using easy and cheap permitted chemical preservatives such aspropionic, sorbic, and citric acids or their salts with little concentrations ranging between 0.001% to 0.3% (Marin et al., 2003). Although permitted; long-term consumption of some other chemical preservatives leads to several side reactions which can be either immediate or build up in the body over time, such as; headaches, palpitations, allergies, and even cancer. Allergies are recently linked to benzoates consumption (Sanjay, 2015).

Fig. 4. Degree of acceptance of the examined cream-based cake “Tourta” and Gateau samples according to the Egyptian Standards (ES: 4037, 2020); it should be free from E. coli, S. aureus, B. cereus, Salmonella spp. and mold. (A): international brand; (B): national brand; (C): local brand.

Therefore, producers and researchers had extensively searched for natural and safe replacers to improve the final cake product quality, prolong its shelf life and guarantee human safety, for example, the use of alcohol (Cauvain and Young, 2006), which is not accepted in Islamic countries, bacteriocins (Carla and Maria, 2009), ginger and turmeric (Muhammad et al., 2014).

The persistence of cake products in markets for several days with constant quality indicates indeed the use of inhibitory substances during processing as a chemical preservative. Unfortunately, none of the examined samples in our study showed positive results using the modified B. subtilis microbial assay method, which may be attributed to lower sensitivity and specificity of this technique. Therefore, further studies are needed to find other more reliable, sensitive, and robust methods such as using chromatographic techniques; such as high-performance liquid chromatography; in order to detect or even determine the level of specific chemical substances in such products (Mahantesh et al., 2019).


Conclusion

Our findings in this study have shown that cream-based dairy confectioneries, especially “Gateau” products from local shops, are considered a source of hazards as they can transmit pathogens and toxins to the consumer, especially the toxigenic strains of B. cereus. It is significant to adopt strict control measures during various stages of processing of such products starting from raw material selection until serving the final product to the consumer. The high incidence of pathogens with the ability of toxin production (B. cereus and S. aureus) points out the need for preventing post-baking contamination which requires careful attention to Good hygienic and manufacturing practices. The Egyptian standard specifications of cake ES: 4037/2020 do not include total colony and coliform counts in its parameters and it is recommended to be added. It is strongly recommended that all the principles of food hygiene be observed by the confectioneries producers in Egypt. Further studies are needed to access the most suitable method to determine the limit and detect the type of inhibitory substance/s added to such products.

Conflict of interest

The authors declare that there is no conflict of interest.

Author contributions

All authors contributed to the aim and design of work; Ashraf Moawad planned the study conception and design. Material preparation, data collection, and analysis were performed by Ayah Abdel-Salam and Esraa Owais. Statistical analyses were performed by Esraa Owais. The first draft of the manuscript was written by Ayah Abdel-Salam and Esraa Owais. All authors commented on previous versions of the manuscript. Then the final manuscript was revised by Ashraf Moawad. All authors read and approved the final version of the manuscript.

Funding

There was no funding source for this study, it was all as a contribution from authors.

Availability of data

All data supporting the findings of this study are available within the manuscript. Any extra data needed are available from the corresponding author upon reasonable request.


References

Abd El-Rady, M.F., Nagwa, M.H., Nessrien, M.Y., Abd El-Razik, M.M. and Fahmy, H.A. 2016. Implementation of hazard analysis critical control points (HACCP) principles in production of filling cream. J. Agric. Sci. Ain Shams Univ. Cairo. 24(1), 207–218.

Adam A.H., Salwa A.A. and Saad M.F. 2021. Evaluation of microbial quality and safety of selected dairy products with special focus on toxigenic genes of Bacillus cereus. Mljekarstvo 71(4), 257–268.

Anunciaçao, L.L., Linardi, W.R., Do Carmo, L.S. and Bergdoll, M.S. 1995. Production of staphylococcal enterotoxin a in cream-filled cake. Int. J. Food Microbial. 26, 259–263.

APHA. 2015. American public health association. compendium of methods for the microbiological examination of foods, 5th ed. Washington, DC

Asao, T., Kumeda, Y., Kawai, T., Shibata, T., Oda, H. and Haruki, K. 2003. An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan: estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol. Infect. 130, 33–40.

Bennet, S.D., Walsh, K.A. and Gould, L.H. 2013. Foodborne disease outbreaks caused by Bacillus cereus, Clostridium perfringens, and Staphylococcus aureus—United States, 1998-2008. Clin. Infect. Dis. 5(3), 425–433.

Bennett, R.W., Hait, J.M. and Tallent, S.M. 2015a. Staphylococcus aureus and staphylococcal enterotoxins. In: Compendium of Methods for the microbiological examination of foods, 5th ed. Washington, DC: American Public Health Association, , Chapter 39, pp 509–526.

Bennett, R., Tallent, S. and Hait, J. 2015b. Bacillus cereus. In: Compendium of methods for the microbiological examination of foods, 5th ed. Washington, DC: American Public Health Association, , . Chapter 31, pp: 375–390.

Brenner, D.J. and Farmer, J.J., III. 2005. Family Enterobacteriaceae. In: Bergey’s Manual of Systematic Bacteriology. 2nd ed, The Proteobacteria. Springer Science Business Media Inc., New York, NY, Vol, 2, pp 587–607.

Brown, M. 2008. Chilled foods: acomprehensive guide, microbiological hazards and safe design, 3rd ed. Cambridge, UK: Woodhead Publishing Series in Food Science, Technology and Nutrition, pp: 191–239.

Carla, L.G. and Maria, I.T. 2009. Prevention of bread mold spoilage by using lactic acid bacteria with antifungal properties. J. Food Sci. 20, 144–148.

Cauvain, S.P. and Young, L.S. 2006. Baked products: science, technology and practice. Hoboken, NJ: Wiley-Blackwell.

CDC (Centers for Disease Control and Prevention). 2016. Multistate Outbreak of Shiga toxin-producing Escherichia coli O145 infections linked to flour (Final Update).

CDC (Centers for Disease Control and Prevention). 2021. E. coli illness linked to cake batter: Harlee’s story. Available via https://www.cdc.gov/foodsafety/patient-stories/Harlee-Ecoli.html (Accessed 26 January 2023).

CDC (Centers for Disease Control and Prevention). 2022. The types of Salmonella that most commonly cause diarrheal illness. Available via https://www.cdc.gov/salmonella/index.html (Accessed 26 January 2023).

Choi, K.H., Lee, H., Lee, S., Kim, S. and Yoon, Y. 2016. Cheese microbial risk assessments—a review. Asian-Aust. J. Anim. Sci. 29, 307–314.

Da Silva, N., Taniwaki, H.M., Junqueira, V.C.A., Silveira, N., Okazaki, M.M. and Romeiro Gomes, R.A. 2018. Microbiological examination methods of food and water: a laboratory manual, 2nd ed. CRC Press. https://doi.org/10.1201/9781315165011 (Accessed 27 February 2023).

Das, S., Lalitha, K. and Thampuran, N. 2013. Isolation and molecular characterization of atypical enterotoxigenic Bacillus cereus with negative Voges-Proskauer reaction from Indian white shrimp. Indian J. Fish. 60(4), 113–117.

EFSA and ECDC. 2014. The European union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2012. EFSA. J. 12, 312.

Ehling-Schulz, M., Guinebretiere, M., Monthán, A., Berge, O., Fricker, M. and Svensson, B. 2006. Toxin gene pro¢ling of enterotoxic and emetic Bacillus cereus. FEMS Microbiol. Lett. 260, 232–240.

El-Fadaly H., El-Kadi, S. and El-Gayar, E. 2016. Microbiological examination for some chocolate cake samples. J. Environ. Sci. Mansoura. Univ. 45(1), 11–27.

ES: 4037/2020, Egyptian standard (4037/ 2020). 2020. Cake specification part 1/1, Egyptian organization for standardization and quality control, ministry of industry, Cairo, Egypt. https://www.eos.org.eg/ar/standard/1265

Esraa, O., Ayah, B.A. and Ashraf, A.M. 2022. Assessment of the knowledge, attitudes, and practices (KAP) about cream-based cakes safety and quality among different consumers in Egypt. J. Egypt Vet. Med. Assoc. 82(1), 247–262.

Esraa, A. O., Ayah B. and Ashraf, A. M. 2023. Chemical composition and nutritive value of cream-based cakes from different brands with special focus on saturated and trans fatty acids Hazard. J. Adv Vet Res. 13(4), 613–620.

FDA (United States Food and Drug Administration). 2012. Bad bug book, foodborne pathogenic microorganisms and natural toxins, 2nd ed [Online]. Food and Drug Administration. Available from: www.fda.gov/Food/FoodborneIllness

Fielding, J.E., Snell, P., Milazzo, A., Del Fabbro, L. and Raupach, J. 2003. An outbreak of Salmonella Typhimurium phage type 4 linked to cold set cheesecake. Commun. Dis. Intell. Q. Rep. 27(4), 513–514.

FSAI (Food Safety Authority of Irland). 2011. Staphylococcus aureus microbial factsheet Series. 1. https://www.fsai.ie/staphylococcusaureus.html

FSAI (Food Safety Authority of Irland). 2018. Survey of the microbiological safety of ready-to-eat cakes, pastries and desserts with high-risk fillings (14NS1), monitoring and surveillance series, Microbiology. https://www.fsai.ie/cakes_pastries_desserts_microbiological_survey/

Hanee, M.A. 2013. Cake four: functionality and quality (Review). Europ. Sci. J. 9(3), 166–180.

Hassan, H., Borzoo, T., Zahra, A. and Majid, A. 2018. Microbial contamination of cream filled pastries supplied in confectioneries of Zanjan, Iran. J. Nutr. Fast. Health 6(1), 30–34.

ICMSF (International Commission for the Microbiological Specifications of Foods). 2003. Microorganisms in Foods 7, microbiological testing in food safety management, 2nd ed. Berlin, Germany: Springer. https://doi.org/10.1007/978-3-319-68460-4.

ISO (International Organization for Standardization). 2008. ISO 21527-1:2008. Microbiology of food and animal feeding stuffs—horizontal method for the enumeration of yeasts and moulds—Part 1: Colony count technique in products with water activity greater than 0.95. Geneva, Switzerland: ISO.

ISO (International Organization for Standardization). 2013. ISO 4833-1:2013. Microbiology of the food chain—horizontal method for the enumeration of microorganisms—Part 1: colony count at 30 °C by the pour plate technique. Geneva, Switzerland: ISO.

ISO (International Organization for Standardization). 2017. ISO 6579-1:2017. Microbiology of the food chain: Horizontal method for the detection, enumeration and serotyping of Salmonella, Part 1: detection of Salmonella spp. 5th ed.Geneva, Switzerland: ISO.

Jay, J.M. 2000. Modern Food Microbiology, 6th ed. Gaithersburg, Maryland: Aspen Publishers Inc.

Kornacki, J.L., Gurtler, J.B. and Stawick, B.A. 2015. Enterobacteriaceae, coliforms, and Escherichia coli as quality and safety indicators. In: Compendium of Methods for the Microbiological Examination of Foods, 5th ed. American Public Health Association, Washington, DC, Chapter 9, 2015, pp: 103–120.

Kotiranta, A., Lounatmaa, K. and Haapasalo, M. 2000. Epidemiology and pathogenesis of B. cereus infections. Microbes. Infect. 2, 189–198.

Logan, N.A. and De Vos, P. 2009. Genus Bacillus. In: Bergey’s manual of systematic bacteriology. 2nd ed. New York, NY: Springer Vol, 3. pp: 21–128.

Mahantesh, K., Yasser, H.I.M., Saad, A., Mostafa, A., Praveen, S. and Sudisha, J. 2019. Detection and determination of stability of the antibiotic residues in cow’s milk, PLoS. One. 14(10), e0223475.

Marin, S.G., Sanchis, M.E., Arbones, V.J. and Ramos, A.J. 2003. Aspergillus flavus, Aspergillus niger and Penicillium coryophilum spoilage prevention of bakery product by means of weak-acid preservatives. J. Food Sci. 64, 2271.

Muhammad, A., Ziaur, R., Ayub, M., Durrani, Y., Ali, S., Abroo, T., Ashbala, S., Majid, K. and Arsalan, K. 2014. Inhibitory effect of ginger and turmeric on Rhizopus stolonifer growth on bread. J. Food. Process. Technol. 5, 5.

Nicoletta, A.M., Di Monaco, R., Masia, P. and Cavellaa, S. 2015. Reduced-calorie filling cream: formula optimization and mechanical characterization. Chem. Engin. Transact. 43, 1–6.

Pereira, M.L., Do Carmo, L.S., Dos Santos, E.J. and Bergdoll, M.S. 1994. Staphylococcal food poisoning from cream-filled cake in a metropolitan area of south-eastern Brazil. Rev. Saude. Publica. 28, 406–409.

Peter, F.J. 2008. Practical Action Publishing, 2008. Available via https://www.ctc-n.org/sites/www.ctc-n.org/files/resources/53565389-748c-4424-b8b0-22dd0a000075.pdf

Rodriguez-Garcia, J., Salvador, A. and Hernando, I. 2012. Optimization of a sponge cake formulation with inulin as fat replacer: structure, physicochemical, and sensory properties. J. Food Sci. 77(2), C189–197.

Sambrook, J., Fritsch, E.R. and Maniatis, T. 1989. Molecular cloning: a laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.

Sanjay, S. 2015. Food preservatives and their harmful effects. Inter. J. Sci. Res. Publ. 5(4), 1–2.

Saranraj, P. and Geetha, M. 2012. Microbial spoilage of bakery products and its control by preservatives. Inter. J. Pharm. Biol. Arch. 3(1), 38–48.

Shandeep, S.G., Shanthi, A., Kalaiarasan, P. and Swarnapriya, R. 2021. Compatibility studies between different bacterial and fungal biocontrol agents and neem cake for management of root knot nematode, Meloidogyne incognita in okra. Pharm. Innov. Int. J. 10(12), 73–76.

Sharifzadeh, A., Hajsharifi-Shahreza, M. and Ghasemi-Dehkordi, P. 2016. Evaluation of microbial contamination and chemical qualities of cream-filled pastries in confectioneries of chaharmahal Va Bakhtiari Province (Southwestern Iran). Osong. Public. Health. Res. Perspect. 7(6), 346–350.

Sherif, M.E., Husain, A.E. and El-Said M.E. 2018. Examination of pathogenic bacteria in some cake samples. Inter. J. Micro. Appli. 5(3), 56–63.

Shohana, A., Anasua, S. and Kamal, K. 2019. Occurrence of pathogenic microorganisms in dessert items collected from Dhaka city. Stamford J. Microbiol. 9(1), 19–22.

Taylor, T.M., Sofos, J.N., Bodnaruk, P. and Acuff, G.R. 2015. Sampling plans, sample collection, shipment, and preparation for analysis. In: Compendium of Methods for the Microbiological Examination of Foods, 5th ed. American Public Health Association, Washington, DC, Chapter 2, pp: 13–25.

Vincenzo, A., Elisabetta, B., Dayana, C., Valeria, S., Giuseppe, P. and Ombretta, M. 2020. Effect of baking time and temperature on nutrients and phenolic compounds content of fresh sprouts bread like product. Foods 9(10), 1447.

Visan, C.C. and Bara, C.I. 2010. Useful microbiological testing of confectionery products quality. Sci. Ann Alexandru Ioan Cuza” Genet Mol Biol Sec. TOM XI, 2010. 119–124

Wallaa F.A. 2018. Occurrence of Bacillus cereus in some milk-based desserts. Assiut Vet. Med. J. 64(156), 41–46.

WHO (World Health organization). 2007. World Health Organization Food Safety & Food-borne Illness. Geneva, Switzerland: World Health Organization.

Wiwanitkit, V. 2015. Food poisoning due to cake intake: a case study. Ann. Trop. Med. Public Health 8, 307.

Zhao, S., Chen, J., Fei, P., Feng, H., Wang, Y., Ali, M.A., Li, S., Jing, H. and Yang, W. 2020. Prevalence, molecular characterization, and antibiotic susceptibility of Bacillus cereus isolated from dairy products in China. J. Dairy Sci. 103, 3994–4001.



How to Cite this Article
Pubmed Style

Abdelrasoul EO, Moawad AA, Abdel-salam AB. Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Vet. J.. 2023; 13(7): 807-818. doi:10.5455/OVJ.2023.v13.i7.1


Web Style

Abdelrasoul EO, Moawad AA, Abdel-salam AB. Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. https://www.openveterinaryjournal.com/?mno=151541 [Access: June 26, 2026]. doi:10.5455/OVJ.2023.v13.i7.1


AMA (American Medical Association) Style

Abdelrasoul EO, Moawad AA, Abdel-salam AB. Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Vet. J.. 2023; 13(7): 807-818. doi:10.5455/OVJ.2023.v13.i7.1



Vancouver/ICMJE Style

Abdelrasoul EO, Moawad AA, Abdel-salam AB. Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Vet. J.. (2023), [cited June 26, 2026]; 13(7): 807-818. doi:10.5455/OVJ.2023.v13.i7.1



Harvard Style

Abdelrasoul, E. O., Moawad, . A. A. & Abdel-salam, . A. B. (2023) Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Vet. J., 13 (7), 807-818. doi:10.5455/OVJ.2023.v13.i7.1



Turabian Style

Abdelrasoul, Esraa O., Ashraf A. Moawad, and Ayah B. Abdel-salam. 2023. Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Veterinary Journal, 13 (7), 807-818. doi:10.5455/OVJ.2023.v13.i7.1



Chicago Style

Abdelrasoul, Esraa O., Ashraf A. Moawad, and Ayah B. Abdel-salam. "Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping." Open Veterinary Journal 13 (2023), 807-818. doi:10.5455/OVJ.2023.v13.i7.1



MLA (The Modern Language Association) Style

Abdelrasoul, Esraa O., Ashraf A. Moawad, and Ayah B. Abdel-salam. "Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping." Open Veterinary Journal 13.7 (2023), 807-818. Print. doi:10.5455/OVJ.2023.v13.i7.1



APA (American Psychological Association) Style

Abdelrasoul, E. O., Moawad, . A. A. & Abdel-salam, . A. B. (2023) Microbiological safety and quality survey of some dairy confectioneries with cream filling and topping. Open Veterinary Journal, 13 (7), 807-818. doi:10.5455/OVJ.2023.v13.i7.1