E-ISSN 2218-6050 | ISSN 2226-4485
 
2026, Vol: 16, Issue: 9
16 / 9Current Issue ArchiveAims and ScopeAbstracting & IndexingMost Accessed ArticlesMost Downloaded ArticlesMost Cited Articles
Required files to be uploaded

OVJ Manuscript Submissio Form
Title Page
mainarticle_template

Research Article


Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae

Maryham M. Aziz, Ali H. Abu Almaaty, Layla Omran Elmajdoub, Mohammad Allam.


Abstract
Background:
Although the systematic relationships between species of several mugilid genera have been better understood thanks to recent research on the molecular phylogeny of the family Mugilidae, there is still a lack of clarity regarding the taxonomic status and evolutionary relationships among certain closely related species.

Aim:
To assess the evolutionary connections of some species of the family Mugilidae, this study used the small mitochondrial rRNA (12S rRNA) gene.

Methods:
Four species (Chelon labrosus, Chelon aurata, Chelon ramada, and Mugil cephalus) were gathered at Port Said city on the Mediterranean Sea. The 12S rRNA gene was amplified in the four species using primers (Marinefsh-12SrRNA-F: ACTAAAGCATAACACTGAAGAT and Marinefsh-12SrRNA-R: TTCATTTCTCTTTCAGCTTTCC).

Results:
The nucleotides of small mitochondrial rRNA sequences were added to GenBank and assigned accession numbers PZ236375.1–PZ236378.1. The length of the small mitochondrial rRNA sequences differed among the samples from 650 bps to 679 bps; Mugil cephalus had 679 bps, whereas Chelon labrosus and Chelon auratus had 650 bps. The A+T combination of 12S rRNA is higher than its C+G ratio.

Conclusion:
The findings of this study highlight the usefulness of small mitochondrial 12S rRNA for the phylogenetic analysis of species in the Mugilidae family.

Key words: Chelon labrosus; Mugil cephalus; Small mitochondrial rRNA.


 
ARTICLE TOOLS
Abstract
PDF Fulltext
How to cite this articleHow to cite this article
Citation Tools
Related Records
 Articles by Maryham M. Aziz
Articles by Ali H. Abu Almaaty
Articles by Layla Omran Elmajdoub
Articles by Mohammad Allam
on Google
on Google Scholar


How to Cite this Article
Pubmed Style

Aziz MM, Almaaty AHA, Elmajdoub LO, Allam M. Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Vet. J.. 2026; 16(9): 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27

Web Style

Aziz MM, Almaaty AHA, Elmajdoub LO, Allam M. Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. https://www.openveterinaryjournal.com/?mno=318565 [Access: September 16, 2026]. doi:10.5455/OVJ.2026.v16.i9.27

AMA (American Medical Association) Style

Aziz MM, Almaaty AHA, Elmajdoub LO, Allam M. Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Vet. J.. 2026; 16(9): 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


Vancouver/ICMJE Style

Aziz MM, Almaaty AHA, Elmajdoub LO, Allam M. Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Vet. J.. (2026), [cited September 16, 2026]; 16(9): 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


Harvard Style

Aziz, M. M., Almaaty, . A. H. A., Elmajdoub, . L. O. & Allam, . M. (2026) Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Vet. J., 16 (9), 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


Turabian Style

Aziz, Maryham M., Ali H. Abu Almaaty, Layla Omran Elmajdoub, and Mohammad Allam. 2026. Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Veterinary Journal, 16 (9), 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


Chicago Style

Aziz, Maryham M., Ali H. Abu Almaaty, Layla Omran Elmajdoub, and Mohammad Allam. "Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae." Open Veterinary Journal 16 (2026), 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


MLA (The Modern Language Association) Style

Aziz, Maryham M., Ali H. Abu Almaaty, Layla Omran Elmajdoub, and Mohammad Allam. "Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae." Open Veterinary Journal 16.9 (2026), 6203-6209. Print. doi:10.5455/OVJ.2026.v16.i9.27


APA (American Psychological Association) Style

Aziz, M. M., Almaaty, . A. H. A., Elmajdoub, . L. O. & Allam, . M. (2026) Molecular phylogeny using 12S rRNA sequence in some species of the family Mugilidae. Open Veterinary Journal, 16 (9), 6203-6209. doi:10.5455/OVJ.2026.v16.i9.27


Author LoginReviewer LoginAbout PublisherOpen Access PolicyEditorial PoliciesEditorial Review PolicyEditorial & Peer Review ProcessPublication Ethics and Publication Malpractice StatementConflict of Interest PolicyPlagiarism PolicyProtection of Research Participants (Statement On Human And Animal Rights)Corrections, Retractions & Expressions of ConcernSelf-Archiving PoliciesDigital Archiving & Preservation PoliciesStatement of Informed ConsentAdvertising PolicyAI PolicyTerms of UseLicense InformationCopyright Information

About Open Veterinary Journal

About the JournalOpen Veterinary Journal (OVJ) is an international, peer-reviewed, open-access journal dedicated to the publication and dissemination of h ... Read more.



For best results, please use Internet Explorer or Google Chrome.

Contact Information

All correspondence should be addressed to:

Prof. Ibrahim Eldaghayes

Editor-in-Chief

Open Veterinary Journal

Faculty of Veterinary Medicine, University of Tripoli

P.O. Box 13662, Tripoli, Libya

Email: ibrahim.eldaghayes@vetmed.edu.ly