E-ISSN 2218-6050 | ISSN 2226-4485
 
2024, Vol: 14, Issue: 10
14 / 10Current Issue ArchiveAims and ScopeAbstracting & IndexingMost Accessed ArticlesMost Downloaded ArticlesMost Cited Articles
Required files to be uploaded

OVJ Manuscript Submission Form

Research Article


Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Abdul Rohman, Hazza’ Hammam Nawwaruddin, Hari Widada, M. A. Motalib Hossain, Marlyn Dian Laksitorini, Dwi Lestari.


Abstract
Background:
Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM).
Aim:
This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
Methods:
This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
Results:
The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples.
Conclusion:
The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Key words: Halal authentication, Rat meat, Meatball, RT-PCR, Species-specific primer


 
ARTICLE TOOLS
Abstract
PDF Fulltext
How to cite this articleHow to cite this article
Citation Tools
Related Records
 Articles by Abdul Rohman
Articles by Hazza’ Hammam Nawwaruddin
Articles by Hari Widada
Articles by M. A. Motalib Hossain
Articles by Marlyn Dian Laksitorini
Articles by Dwi Lestari
on Google
on Google Scholar


How to Cite this Article
Pubmed Style

Rohman A, Nawwaruddin HH, Widada H, Hossain MAM, Laksitorini MD, Lestari D. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Vet J. 2024; 14(9): 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37

Web Style

Rohman A, Nawwaruddin HH, Widada H, Hossain MAM, Laksitorini MD, Lestari D. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. https://www.openveterinaryjournal.com/?mno=210204 [Access: November 08, 2024]. doi:10.5455/OVJ.2024.v14.i9.37

AMA (American Medical Association) Style

Rohman A, Nawwaruddin HH, Widada H, Hossain MAM, Laksitorini MD, Lestari D. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Vet J. 2024; 14(9): 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


Vancouver/ICMJE Style

Rohman A, Nawwaruddin HH, Widada H, Hossain MAM, Laksitorini MD, Lestari D. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Vet J. (2024), [cited November 08, 2024]; 14(9): 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


Harvard Style

Rohman, A., Nawwaruddin, . H. H., Widada, . H., Hossain, . M. A. M., Laksitorini, . M. D. & Lestari, . D. (2024) Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Vet J, 14 (9), 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


Turabian Style

Rohman, Abdul, Hazza' Hammam Nawwaruddin, Hari Widada, M. A. Motalib Hossain, Marlyn Dian Laksitorini, and Dwi Lestari. 2024. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Veterinary Journal, 14 (9), 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


Chicago Style

Rohman, Abdul, Hazza' Hammam Nawwaruddin, Hari Widada, M. A. Motalib Hossain, Marlyn Dian Laksitorini, and Dwi Lestari. "Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication." Open Veterinary Journal 14 (2024), 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


MLA (The Modern Language Association) Style

Rohman, Abdul, Hazza' Hammam Nawwaruddin, Hari Widada, M. A. Motalib Hossain, Marlyn Dian Laksitorini, and Dwi Lestari. "Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication." Open Veterinary Journal 14.9 (2024), 2484-2492. Print. doi:10.5455/OVJ.2024.v14.i9.37


APA (American Psychological Association) Style

Rohman, A., Nawwaruddin, . H. H., Widada, . H., Hossain, . M. A. M., Laksitorini, . M. D. & Lestari, . D. (2024) Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication. Open Veterinary Journal, 14 (9), 2484-2492. doi:10.5455/OVJ.2024.v14.i9.37


Author LoginReviewer LoginAbout PublisherPublication Ethics and Publication Malpractice StatementConflict of Interest PolicyPlagiarism PolicyTerms of UseLicense Information

About Open Veterinary Journal

Open Veterinary Journal provides a fast track coupled with high quality peer review process for original research articles, review articles, short communi ... Read more.



For best results, please use Internet Explorer or Google Chrome.

Contact Information

All correspondence should be addressed to:

Prof. Ibrahim Eldaghayes: Owner, Founder and Editor-in-Chief

Open Veterinary Journal


Faculty of Veterinary Medicine, University of Tripoli

P.O. Box 13662, Tripoli, Libya

and


Eldaghayes Publisher

www.eldagpublisher.com 

Email: ibrahim.eldaghayes@vetmed.edu.ly